keyword in microRNA or target gene :
The pre-miRNA of MI0003513
Gene
HGNC MIRN455
Accession no
MI0003513
ID
hsa-mir-455
Species
Homo sapiens
Description
Homo sapiens miR-455 stem-loop
Genomic Location
9 : 116011535 - 116011630 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000356083 intron + 10
ENST00000357257 intron + 10
ENST00000374106 intron + 5
OTTHUMT00000053763 intron + 10
OTTHUMT00000053766 intron + 5
OTTHUMT00000053764 intron + 7
View the flanking features in the Genome Browser
Pre-miRNA length
96 nt
Comments
The mir-455 precursor was predicted computationally and a mature product verified in human by Northern blot [1]. The precise sequence termini of the mature form were derived by cloning from human and rat samples (Landgraf and Tuschl, unpublished).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
dre-mir-455 fru-mir-455 tni-mir-455 hsa-mir-455 gga-mir-455
mmu-mir-455 xtr-mir-455 bta-mir-455
The mature miRNA of MI0003513
Mature name
hsa-miR-455
Mature sequence
16| 5'- UAUGUGCCUUUGGACUACAUCG -3' |37
Target genes
ENST00000378609 (targeted by hsa-miR-455, predicted by TargetScan)
Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta 1 (Transducin beta chain 1). [Source:Uniprot/SWISSPROT;Acc:P62873]
 
     
ENST00000378606 (targeted by hsa-miR-455, predicted by TargetScan)
Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta 1 (Transducin beta chain 1). [Source:Uniprot/SWISSPROT;Acc:P62873]
 
     
ENST00000378466 (targeted by hsa-miR-455, predicted by TargetScan)
Pantothenate kinase 4 (EC 2.7.1.33) (Pantothenic acid kinase 4) (hPanK4). [Source:Uniprot/SWISSPROT;Acc:Q9NVE7]
 
     
   
 
The reference
Literature
1. "Phylogenetic shadowing and computational identification of human microRNA genes"
  Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E
  Cell. 120:21-24(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 485078 0937119471