keyword in microRNA or target gene :
The pre-miRNA of MI0003190
Gene
HGNC MIRN505
EMBL AY785933
Accession no
MI0003190
ID
hsa-mir-505
Species
Homo sapiens
Description
Homo sapiens miR-505 stem-loop
Genomic Location
X : 138833973 - 138834056 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000370557 intron + 1
OTTHUMT00000058570 intron + 1
OTTHUMT00000058566 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
84 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-505 rno-mir-505 mmu-mir-505
The mature miRNA of MI0003190
Mature name
hsa-miR-505
Mature sequence
52| 5'- GUCAACACUUGCUGGUUUCCUC -3' |73
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000321423 (targeted by hsa-miR-505, predicted by TargetScan)
Cyclin-L2 (Paneth cell-enhanced expression protein). [Source:Uniprot/SWISSPROT;Acc:Q96S94]
 
     
ENST00000344606 (targeted by hsa-miR-505, predicted by TargetScan)
Cyclin-L2 (Paneth cell-enhanced expression protein). [Source:Uniprot/SWISSPROT;Acc:Q96S94]
 
     
ENST00000375753 (targeted by hsa-miR-505, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 72782 0937119471