keyword in microRNA or target gene :
The pre-miRNA of MI0003188
Gene
HGNC MIRN503
EMBL AY882283
Accession no
MI0003188
ID
hsa-mir-503
Species
Homo sapiens
Description
Homo sapiens miR-503 stem-loop
Genomic Location
X : 133508024 - 133508094 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
OTTHUMT00000058370 intron + 1
OTTHUMT00000058369 intron + 1
OTTHUMT00000058372 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
71 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-503 mmu-mir-503 rno-mir-503
The mature miRNA of MI0003188
Mature name
hsa-miR-503
Mature sequence
6| 5'- UAGCAGCGGGAACAGUUCUGCAG -3' |28
Target genes
ENST00000378567 (targeted by hsa-miR-503, predicted by TargetScan)
Protein kinase C zeta type (EC 2.7.11.13) (nPKC-zeta). [Source:Uniprot/SWISSPROT;Acc:Q05513]
 
     
ENST00000356315 (targeted by hsa-miR-503, predicted by TargetScan)
Vacuolar protein sorting-associated protein 13D. [Source:Uniprot/SWISSPROT;Acc:Q5THJ4]
 
     
ENST00000011700 (targeted by hsa-miR-503, predicted by TargetScan)
Vacuolar protein sorting-associated protein 13D. [Source:Uniprot/SWISSPROT;Acc:Q5THJ4]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
2. "Identification of clustered microRNAs using an ab initio prediction method"
  Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
  BMC Bioinformatics. 6:267(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 887069 0937119471