keyword in microRNA or target gene :
The pre-miRNA of MI0003186
Gene
HGNC MIRN502
EMBL AY882317
Accession no
MI0003186
ID
hsa-mir-502
Species
Homo sapiens
Description
Homo sapiens miR-502 stem-loop
Genomic Location
X : 49665946 - 49666031 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000376108 intron + 3
ENST00000376091 intron + 3
OTTHUMT00000109349 intron + 3
OTTHUMT00000056542 intron + 3
OTTHUMT00000056543 intron + 3
View the flanking features in the Genome Browser
Pre-miRNA length
86 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-500 hsa-mir-501 hsa-mir-502 rno-mir-501 mmu-mir-500
mmu-mir-501
The mature miRNA of MI0003186
Mature name
hsa-miR-502
Mature sequence
16| 5'- AUCCUUGCUAUCUGGGUGCUA -3' |36
Target genes
ENST00000270724 (targeted by hsa-miR-502, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378964 (targeted by hsa-miR-502, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378935 (targeted by hsa-miR-502, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 685661 0937119471