keyword in microRNA or target gene :
The pre-miRNA of MI0003184
Gene
HGNC MIRN500
EMBL AY882306
Accession no
MI0003184
ID
hsa-mir-500
Species
Homo sapiens
Description
Homo sapiens miR-500 stem-loop
Genomic Location
X : 49659779 - 49659862 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000376108 intron + 3
ENST00000376091 intron + 3
OTTHUMT00000109349 intron + 3
OTTHUMT00000056542 intron + 3
OTTHUMT00000056543 intron + 3
View the flanking features in the Genome Browser
Pre-miRNA length
84 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-500 hsa-mir-501 hsa-mir-502 rno-mir-501 mmu-mir-500
mmu-mir-501
The mature miRNA of MI0003184
Mature name
hsa-miR-500
Mature sequence
52| 5'- AUGCACCUGGGCAAGGAUUCUG -3' |73
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000378567 (targeted by hsa-miR-500, predicted by TargetScan)
Protein kinase C zeta type (EC 2.7.11.13) (nPKC-zeta). [Source:Uniprot/SWISSPROT;Acc:Q05513]
 
     
ENST00000353409 (targeted by hsa-miR-500, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000377081 (targeted by hsa-miR-500, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 780192 0937119471