keyword in microRNA or target gene :
The pre-miRNA of MI0003173
Gene
HGNC MIRN518A-2
EMBL AY882297
EMBL AY785914
Accession no
MI0003173
ID
hsa-mir-518a-2
Species
Homo sapiens
Description
Homo sapiens miR-518a-2 stem-loop
Genomic Location
19 : 58934399 - 58934485 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
87 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-520e hsa-mir-515-1 hsa-mir-519e hsa-mir-520f hsa-mir-515-2
hsa-mir-519c hsa-mir-520a hsa-mir-526b hsa-mir-519b hsa-mir-525
hsa-mir-523 hsa-mir-518f hsa-mir-520b hsa-mir-518b hsa-mir-526a-1
hsa-mir-520c hsa-mir-518c hsa-mir-524 hsa-mir-517a hsa-mir-519d
hsa-mir-521-2 hsa-mir-520d hsa-mir-517b hsa-mir-520g hsa-mir-516-3
hsa-mir-526a-2 hsa-mir-518e hsa-mir-518a-1 hsa-mir-518d hsa-mir-516-4
hsa-mir-518a-2 hsa-mir-517c hsa-mir-520h hsa-mir-521-1 hsa-mir-522
hsa-mir-519a-1 hsa-mir-527 hsa-mir-516-1 hsa-mir-516-2 hsa-mir-519a-2
The mature miRNA of MI0003173
Mature name
hsa-miR-527
Mature sequence
16| 5'- CUGCAAAGGGAAGCCCUUUCU -3' |36
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000378322 (targeted by hsa-miR-527, predicted by TargetScan)
WD repeat protein 8. [Source:Uniprot/SWISSPROT;Acc:Q9P2S5]
 
     
ENST00000378317 (targeted by hsa-miR-527, predicted by TargetScan)
WD repeat protein 8. [Source:Uniprot/SWISSPROT;Acc:Q9P2S5]
 
     
ENST00000378320 (targeted by hsa-miR-527, predicted by TargetScan)
WD repeat protein 8. [Source:Uniprot/SWISSPROT;Acc:Q9P2S5]
 
     
   
 
The mature miRNA of MI0003173
Mature name
hsa-miR-518a
Mature sequence
54| 5'- AAAGCGCUUCCCUUUGCUGGA -3' |74
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000375753 (targeted by hsa-miR-518a, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000330072 (targeted by hsa-miR-518a, predicted by TargetScan)
Aflatoxin B1 aldehyde reductase member 2 (EC 1.-.-.-) (AFB1-AR 1) (Aldoketoreductase 7). [Source:Uniprot/SWISSPROT;Acc:O43488]
 
     
ENST00000235835 (targeted by hsa-miR-518a, predicted by TargetScan)
Aflatoxin B1 aldehyde reductase member 2 (EC 1.-.-.-) (AFB1-AR 1) (Aldoketoreductase 7). [Source:Uniprot/SWISSPROT;Acc:O43488]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 254287 0937119471