keyword in microRNA or target gene :
The pre-miRNA of MI0003165
Gene
HGNC MIRN517B
EMBL AY882296
EMBL AY882289
Accession no
MI0003165
ID
hsa-mir-517b
Species
Homo sapiens
Description
Homo sapiens miR-517b stem-loop
Genomic Location
19 : 58916142 - 58916208 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
67 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-520e hsa-mir-515-1 hsa-mir-519e hsa-mir-520f hsa-mir-515-2
hsa-mir-519c hsa-mir-520a hsa-mir-526b hsa-mir-519b hsa-mir-525
hsa-mir-523 hsa-mir-518f hsa-mir-520b hsa-mir-518b hsa-mir-526a-1
hsa-mir-520c hsa-mir-518c hsa-mir-524 hsa-mir-517a hsa-mir-519d
hsa-mir-521-2 hsa-mir-520d hsa-mir-517b hsa-mir-520g hsa-mir-516-3
hsa-mir-526a-2 hsa-mir-518e hsa-mir-518a-1 hsa-mir-518d hsa-mir-516-4
hsa-mir-518a-2 hsa-mir-517c hsa-mir-520h hsa-mir-521-1 hsa-mir-522
hsa-mir-519a-1 hsa-mir-527 hsa-mir-516-1 hsa-mir-516-2 hsa-mir-519a-2
The mature miRNA of MI0003165
Mature name
hsa-miR-517*
Mature sequence
6| 5'- CCUCUAGAUGGAAGCACUGUCU -3' |27
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000375753 (targeted by hsa-miR-517*, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000375753 (targeted by hsa-miR-517*, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000374676 (targeted by hsa-miR-517*, predicted by TargetScan)
Basement membrane-specific heparan sulfate proteoglycan core protein precursor (HSPG) (Perlecan) (PLC). [Source:Uniprot/SWISSPROT;Acc:P98160]
 
     
   
 
The mature miRNA of MI0003165
Mature name
hsa-miR-517b
Mature sequence
44| 5'- UCGUGCAUCCCUUUAGAGUGUU -3' |65
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000359814 (targeted by hsa-miR-517b, predicted by TargetScan)
Noelin-3 precursor (Olfactomedin-3) (Optimedin). [Source:Uniprot/SWISSPROT;Acc:Q96PB7]
 
     
ENST00000361813 (targeted by hsa-miR-517b, predicted by TargetScan)
Protein SMG5 (SMG-5 homolog) (EST1-like protein B) (LPTS-interacting protein) (LPTS-RP1). [Source:Uniprot/SWISSPROT;Acc:Q9UPR3]
 
     
ENST00000367211 (targeted by hsa-miR-517b, predicted by TargetScan)
Zinc finger CCCH domain-containing protein 11A. [Source:Uniprot/SWISSPROT;Acc:O75152]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 385610 0937119471