keyword in microRNA or target gene :
The pre-miRNA of MI0003162
Gene
HGNC MIRN519D
EMBL AY785939
Accession no
MI0003162
ID
hsa-mir-519d
Species
Homo sapiens
Description
Homo sapiens miR-519d stem-loop
Genomic Location
19 : 58908413 - 58908500 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
88 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-520e hsa-mir-515-1 hsa-mir-519e hsa-mir-520f hsa-mir-515-2
hsa-mir-519c hsa-mir-520a hsa-mir-526b hsa-mir-519b hsa-mir-525
hsa-mir-523 hsa-mir-518f hsa-mir-520b hsa-mir-518b hsa-mir-526a-1
hsa-mir-520c hsa-mir-518c hsa-mir-524 hsa-mir-517a hsa-mir-519d
hsa-mir-521-2 hsa-mir-520d hsa-mir-517b hsa-mir-520g hsa-mir-516-3
hsa-mir-526a-2 hsa-mir-518e hsa-mir-518a-1 hsa-mir-518d hsa-mir-516-4
hsa-mir-518a-2 hsa-mir-517c hsa-mir-520h hsa-mir-521-1 hsa-mir-522
hsa-mir-519a-1 hsa-mir-527 hsa-mir-516-1 hsa-mir-516-2 hsa-mir-519a-2
The mature miRNA of MI0003162
Mature name
hsa-miR-519d
Mature sequence
54| 5'- CAAAGUGCCUCCCUUUAGAGUGU -3' |76
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000378675 (targeted by hsa-miR-519d, predicted by TargetScan)
Matrix metalloproteinase-23 precursor (EC 3.4.24.-) (MMP-23) (Matrix metallopeptidase 21) (MMP-21) (Matrix metalloprotease 22) (MMP-22) (Femalysin) (MIFR-1) [Contains: Matrix metalloproteinase-23, soluble form]. [Source:Uniprot/SWISSPROT;Acc:O75900]
 
     
ENST00000375048 (targeted by hsa-miR-519d, predicted by TargetScan)
Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunit precursor (EC 2.4.1.119) (Oligosaccharyl transferase 48 kDa subunit) (DDOST 48 kDa subunit). [Source:Uniprot/SWISSPROT;Acc:P39656]
 
     
ENST00000374933 (targeted by hsa-miR-519d, predicted by TargetScan)
Eukaryotic translation initiation factor 4 gamma 3 (eIF-4-gamma 3) (eIF-4G 3) (eIF4G 3) (eIF-4-gamma II) (eIF4GII). [Source:Uniprot/SWISSPROT;Acc:O43432]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 570821 0937119471