keyword in microRNA or target gene :
The pre-miRNA of MI0003150
Gene
HGNC MIRN526B
EMBL AY882287
Accession no
MI0003150
ID
hsa-mir-526b
Species
Homo sapiens
Description
Homo sapiens miR-526b stem-loop
Genomic Location
19 : 58889459 - 58889541 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
83 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-520e hsa-mir-515-1 hsa-mir-519e hsa-mir-520f hsa-mir-515-2
hsa-mir-519c hsa-mir-520a hsa-mir-526b hsa-mir-519b hsa-mir-525
hsa-mir-523 hsa-mir-518f hsa-mir-520b hsa-mir-518b hsa-mir-526a-1
hsa-mir-520c hsa-mir-518c hsa-mir-524 hsa-mir-517a hsa-mir-519d
hsa-mir-521-2 hsa-mir-520d hsa-mir-517b hsa-mir-520g hsa-mir-516-3
hsa-mir-526a-2 hsa-mir-518e hsa-mir-518a-1 hsa-mir-518d hsa-mir-516-4
hsa-mir-518a-2 hsa-mir-517c hsa-mir-520h hsa-mir-521-1 hsa-mir-522
hsa-mir-519a-1 hsa-mir-527 hsa-mir-516-1 hsa-mir-516-2 hsa-mir-519a-2
The mature miRNA of MI0003150
Mature name
hsa-miR-526b
Mature sequence
14| 5'- CUCUUGAGGGAAGCACUUUCUGUU -3' |37
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000270724 (targeted by hsa-miR-526b, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378964 (targeted by hsa-miR-526b, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378935 (targeted by hsa-miR-526b, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
   
 
The mature miRNA of MI0003150
Mature name
hsa-miR-526b*
Mature sequence
52| 5'- AAAGUGCUUCCUUUUAGAGGC -3' |72
Target genes
ENST00000355249 (targeted by hsa-miR-526b*, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000355249 (targeted by hsa-miR-526b*, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000240185 (targeted by hsa-miR-526b*, predicted by TargetScan)
TAR DNA-binding protein 43 (TDP-43). [Source:Uniprot/SWISSPROT;Acc:Q13148]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 934538 0937119471