keyword in microRNA or target gene :
The pre-miRNA of MI0003139
Gene
HGNC MIRN181D
EMBL AY785944
Accession no
MI0003139
ID
hsa-mir-181d
Species
Homo sapiens
Description
Homo sapiens miR-181d stem-loop
Genomic Location
19 : 13846689 - 13846825 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
137 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-181a-2 hsa-mir-181a-2 hsa-mir-181b-1 hsa-mir-181c hsa-mir-181a-1
hsa-mir-181b-2 mmu-mir-181a-1 mmu-mir-181b-1 mmu-mir-181c mmu-mir-181b-2
rno-mir-181c rno-mir-181a-2 rno-mir-181b-1 rno-mir-181b-2 rno-mir-181a-1
gga-mir-181a-1 gga-mir-181b-1 gga-mir-181b-2 gga-mir-181a-2 dre-mir-181b-1
dre-mir-181b-2 dre-mir-181a-1 dre-mir-181c ssc-mir-181b ssc-mir-181c
ggo-mir-181a-2 ppa-mir-181a-2 ptr-mir-181a-2 mml-mir-181a-2 sla-mir-181a-2
mne-mir-181a-2 mml-mir-181c ptr-mir-181c ggo-mir-181c ppa-mir-181c
mml-mir-181a-1 mml-mir-181b ptr-mir-181a-1 ptr-mir-181b ppy-mir-181a-1
ppy-mir-181b ggo-mir-181a-1 ggo-mir-181b lla-mir-181a-1 lla-mir-181b
mne-mir-181a-1 mne-mir-181b ppa-mir-181a-1 ppa-mir-181b hsa-mir-181d
fru-mir-181b-1 tni-mir-181b-1 fru-mir-181a-1 tni-mir-181a-1 fru-mir-181b-2
tni-mir-181b-2 tni-mir-181a-2 dre-mir-181a-2 fru-mir-181a-2 bta-mir-181a
xtr-mir-181b-1 xtr-mir-181b-2 xtr-mir-181a-1 xtr-mir-181a-2 bta-mir-181b
bta-mir-181c mdo-mir-181c mdo-mir-181a mdo-mir-181b mmu-mir-181d
The mature miRNA of MI0003139
Mature name
hsa-miR-181d
Mature sequence
36| 5'- AACAUUCAUUGUUGUCGGUGGGUU -3' |59
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000337907 (targeted by hsa-miR-181d, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-181d, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000240185 (targeted by hsa-miR-181d, predicted by TargetScan)
TAR DNA-binding protein 43 (TDP-43). [Source:Uniprot/SWISSPROT;Acc:Q13148]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 218987 0937119471