keyword in microRNA or target gene :
The pre-miRNA of MI0003138
Gene
HGNC MIRN497
EMBL AY785913
Accession no
MI0003138
ID
hsa-mir-497
Species
Homo sapiens
Description
Homo sapiens miR-497 stem-loop
Genomic Location
17 : 6861954 - 6862065 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
OTTHUMT00000285704 intron + 1
OTTHUMT00000256411 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
112 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-497 rno-mir-497 mmu-mir-497 bta-mir-497
The mature miRNA of MI0003138
Mature name
hsa-miR-497
Mature sequence
24| 5'- CAGCAGCACACUGUGGUUUGU -3' |44
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000270724 (targeted by hsa-miR-497, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378964 (targeted by hsa-miR-497, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378935 (targeted by hsa-miR-497, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 611604 0937119471