keyword in microRNA or target gene :
The pre-miRNA of MI0003137
Gene
HGNC MIRN193B
Accession no
MI0003137
ID
hsa-mir-193b
Species
Homo sapiens
Description
Homo sapiens miR-193b stem-loop
Genomic Location
16 : 14305325 - 14305407 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
83 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-193 hsa-mir-193a rno-mir-193 dre-mir-193a-1 dre-mir-193a-2
dre-mir-193a-3 dre-mir-193b hsa-mir-193b fru-mir-193 tni-mir-193
gga-mir-193 xtr-mir-193 bta-mir-193a mdo-mir-193
The mature miRNA of MI0003137
Mature name
hsa-miR-193b
Mature sequence
51| 5'- AACUGGCCCUCAAAGUCCCGCUUU -3' |74
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000378609 (targeted by hsa-miR-193b, predicted by TargetScan)
Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta 1 (Transducin beta chain 1). [Source:Uniprot/SWISSPROT;Acc:P62873]
 
     
ENST00000378606 (targeted by hsa-miR-193b, predicted by TargetScan)
Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta 1 (Transducin beta chain 1). [Source:Uniprot/SWISSPROT;Acc:P62873]
 
     
ENST00000377565 (targeted by hsa-miR-193b, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
2. "Identification of clustered microRNAs using an ab initio prediction method"
  Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
  BMC Bioinformatics. 6:267(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 567103 0937119471