keyword in microRNA or target gene :
The pre-miRNA of MI0003135
Gene
HGNC MIRN495
Accession no
MI0003135
ID
hsa-mir-495
Species
Homo sapiens
Description
Homo sapiens miR-495 stem-loop
Genomic Location
14 : 100569845 - 100569926 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
82 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
rno-mir-329 mmu-mir-329 hsa-mir-329-1 hsa-mir-329-2 hsa-mir-495
mmu-mir-543 rno-mir-543 mmu-mir-495
The mature miRNA of MI0003135
Mature name
hsa-miR-495
Mature sequence
50| 5'- AAACAAACAUGGUGCACUUCUUU -3' |72
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000375199 (targeted by hsa-miR-495, predicted by TargetScan)
Uncharacterized protein KIAA0090 precursor. [Source:Uniprot/SWISSPROT;Acc:Q8N766]
 
     
ENST00000375010 (targeted by hsa-miR-495, predicted by TargetScan)
HP1-BP74 [Source:RefSeq_peptide;Acc:NP_057371]
 
     
ENST00000375004 (targeted by hsa-miR-495, predicted by TargetScan)
HP1-BP74 [Source:RefSeq_peptide;Acc:NP_057371]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 237224 0937119471