keyword in microRNA or target gene :
The pre-miRNA of MI0003133
Gene
HGNC MIRN432
EMBL AY785934
Accession no
MI0003133
ID
hsa-mir-432
Species
Homo sapiens
Description
Homo sapiens miR-432 stem-loop
Genomic Location
14 : 100420573 - 100420666 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
94 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
oar-mir-432 hsa-mir-432
The mature miRNA of MI0003133
Mature name
hsa-miR-432
Mature sequence
14| 5'- UCUUGGAGUAGGUCAUUGGGUGG -3' |36
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000338591 (targeted by hsa-miR-432, predicted by TargetScan)
Kelch-like protein 17 (Actinfilin). [Source:Uniprot/SWISSPROT;Acc:Q6TDP4]
 
     
ENST00000379420 (targeted by hsa-miR-432, predicted by TargetScan)
Kelch-like protein 17 (Actinfilin). [Source:Uniprot/SWISSPROT;Acc:Q6TDP4]
 
     
ENST00000378398 (targeted by hsa-miR-432, predicted by TargetScan)
PR domain zinc finger protein 16 (PR domain-containing protein 16) (Transcription factor MEL1). [Source:Uniprot/SWISSPROT;Acc:Q9HAZ2]
 
     
   
 
The mature miRNA of MI0003133
Mature name
hsa-miR-432*
Mature sequence
62| 5'- CUGGAUGGCUCCUCCAUGUCU -3' |82
Target genes
ENST00000377998 (targeted by hsa-miR-432*, predicted by TargetScan)
Chromodomain helicase-DNA-binding protein 5 (EC 3.6.1.-) (ATP- dependent helicase CHD5) (CHD-5). [Source:Uniprot/SWISSPROT;Acc:Q8TDI0]
 
     
ENST00000377998 (targeted by hsa-miR-432*, predicted by TargetScan)
Chromodomain helicase-DNA-binding protein 5 (EC 3.6.1.-) (ATP- dependent helicase CHD5) (CHD-5). [Source:Uniprot/SWISSPROT;Acc:Q8TDI0]
 
     
ENST00000337907 (targeted by hsa-miR-432*, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
2. "Identification of clustered microRNAs using an ab initio prediction method"
  Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
  BMC Bioinformatics. 6:267(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 395345 0937119471