keyword in microRNA or target gene :
The pre-miRNA of MI0003130
Gene
HGNC MIRN202
EMBL AY882277
Accession no
MI0003130
ID
hsa-mir-202
Species
Homo sapiens
Description
Homo sapiens miR-202 stem-loop
Genomic Location
10 : 134911006 - 134911115 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
110 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-202 dre-mir-202 hsa-mir-202 fru-mir-202 tni-mir-202
gga-mir-202 xtr-mir-202-1 xtr-mir-202-2
The mature miRNA of MI0003130
Mature name
hsa-miR-202*
Mature sequence
27| 5'- UUUCCUAUGCAUAUACUUCUUU -3' |48
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000378317 (targeted by hsa-miR-202*, predicted by TargetScan)
WD repeat protein 8. [Source:Uniprot/SWISSPROT;Acc:Q9P2S5]
 
     
ENST00000377565 (targeted by hsa-miR-202*, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-202*, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The mature miRNA of MI0003130
Mature name
hsa-miR-202
Mature sequence
64| 5'- AGAGGUAUAGGGCAUGGGAAAA -3' |85
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000356536 (targeted by hsa-miR-202, predicted by TargetScan)
Protein tyrosine phosphatase type IVA protein 2 (EC 3.1.3.48) (Protein-tyrosine phosphatase 4a2) (Protein-tyrosine phosphatase of regenerating liver 2) (PRL-2) (PTP(CAAXII)) (HU-PP-1) (OV-1). [Source:Uniprot/SWISSPROT;Acc:Q12974]
 
     
ENST00000332500 (targeted by hsa-miR-202, predicted by TargetScan)
Protein tyrosine phosphatase type IVA protein 2 (EC 3.1.3.48) (Protein-tyrosine phosphatase 4a2) (Protein-tyrosine phosphatase of regenerating liver 2) (PRL-2) (PTP(CAAXII)) (HU-PP-1) (OV-1). [Source:Uniprot/SWISSPROT;Acc:Q12974]
 
     
ENST00000344035 (targeted by hsa-miR-202, predicted by TargetScan)
Protein tyrosine phosphatase type IVA protein 2 (EC 3.1.3.48) (Protein-tyrosine phosphatase 4a2) (Protein-tyrosine phosphatase of regenerating liver 2) (PRL-2) (PTP(CAAXII)) (HU-PP-1) (OV-1). [Source:Uniprot/SWISSPROT;Acc:Q12974]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 631341 0937119471