keyword in microRNA or target gene :
The pre-miRNA of MI0003129
Gene
HGNC MIRN146B
EMBL AY882276
Accession no
MI0003129
ID
hsa-mir-146b
Species
Homo sapiens
Description
Homo sapiens miR-146b stem-loop
Genomic Location
10 : 104186259 - 104186331 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
73 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-146 hsa-mir-146a rno-mir-146 gga-mir-146a dre-mir-146a
dre-mir-146b-1 dre-mir-146b-2 hsa-mir-146b gga-mir-146b mmu-mir-146b
xtr-mir-146
The mature miRNA of MI0003129
Mature name
hsa-miR-146b
Mature sequence
9| 5'- UGAGAACUGAAUUCCAUAGGCU -3' |30
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000375753 (targeted by hsa-miR-146b, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000375753 (targeted by hsa-miR-146b, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000375753 (targeted by hsa-miR-146b, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 469646 0937119471