keyword in microRNA or target gene :
The pre-miRNA of MI0003125
Gene
HGNC MIRN490
EMBL AY882316
Accession no
MI0003125
ID
hsa-mir-490
Species
Homo sapiens
Description
Homo sapiens miR-490 stem-loop
Genomic Location
7 : 136238454 - 136238581 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000320658 intron + 2
OTTHUMT00000137319 intron - 3
OTTHUMT00000138721 intron + 2
OTTHUMT00000138720 intron + 2
OTTHUMT00000138722 intron + 2
OTTHUMT00000137490 intron - 2
View the flanking features in the Genome Browser
Pre-miRNA length
128 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-490 gga-mir-490 mmu-mir-490
The mature miRNA of MI0003125
Mature name
hsa-miR-490
Mature sequence
76| 5'- CAACCUGGAGGACUCCAUGCUG -3' |97
Target genes
ENST00000377565 (targeted by hsa-miR-490, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-490, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000377083 (targeted by hsa-miR-490, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 487830 0937119471