keyword in microRNA or target gene :
The pre-miRNA of MI0002469
Gene
HGNC MIRN485
EMBL AY882335
EMBL AY882307
Accession no
MI0002469
ID
hsa-mir-485
Species
Homo sapiens
Description
Homo sapiens miR-485 stem-loop
Genomic Location
14 : 100591509 - 100591581 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
73 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-485 mmu-mir-485 rno-mir-485
The mature miRNA of MI0002469
Mature name
hsa-miR-485-5p
Mature sequence
9| 5'- AGAGGCUGGCCGUGAUGAAUUC -3' |30
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000378609 (targeted by hsa-miR-485-5p, predicted by TargetScan)
Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta 1 (Transducin beta chain 1). [Source:Uniprot/SWISSPROT;Acc:P62873]
 
     
ENST00000378606 (targeted by hsa-miR-485-5p, predicted by TargetScan)
Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta 1 (Transducin beta chain 1). [Source:Uniprot/SWISSPROT;Acc:P62873]
 
     
ENST00000378322 (targeted by hsa-miR-485-5p, predicted by TargetScan)
WD repeat protein 8. [Source:Uniprot/SWISSPROT;Acc:Q9P2S5]
 
     
   
 
The mature miRNA of MI0002469
Mature name
hsa-miR-485-3p
Mature sequence
46| 5'- GUCAUACACGGCUCUCCUCUCU -3' |67
Target genes
ENST00000373418 (targeted by hsa-miR-485-3p, predicted by TargetScan)
Polyhomeotic-like protein 2 (hPH2) (Early development regulatory protein 2). [Source:Uniprot/SWISSPROT;Acc:Q8IXK0]
 
     
ENST00000307890 (targeted by hsa-miR-485-3p, predicted by TargetScan)
Polyhomeotic-like protein 2 (hPH2) (Early development regulatory protein 2). [Source:Uniprot/SWISSPROT;Acc:Q8IXK0]
 
     
ENST00000373422 (targeted by hsa-miR-485-3p, predicted by TargetScan)
Polyhomeotic-like protein 2 (hPH2) (Early development regulatory protein 2). [Source:Uniprot/SWISSPROT;Acc:Q8IXK0]
 
     
   
 
The reference
Literature
1. "Identification of human fetal liver miRNAs by a novel method"
  Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X
  FEBS Lett. 579:3849-3854(2005).
2. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 968357 0937119471