keyword in microRNA or target gene :
The pre-miRNA of MI0002468
Gene
HGNC MIRN484
Accession no
MI0002468
ID
hsa-mir-484
Species
Homo sapiens
Description
Homo sapiens miR-484 stem-loop
Genomic Location
16 : 15644652 - 15644730 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
OTTHUMT00000252133 3UTR + 1
OTTHUMT00000155661 3UTR + 1
View the flanking features in the Genome Browser
Pre-miRNA length
79 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-484 mmu-mir-484 bta-mir-484
The mature miRNA of MI0002468
Mature name
hsa-miR-484
Mature sequence
8| 5'- UCAGGCUCAGUCCCCUCCCGAU -3' |29
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000337907 (targeted by hsa-miR-484, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-484, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000355249 (targeted by hsa-miR-484, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
   
 
The reference
Literature
1. "Identification of human fetal liver miRNAs by a novel method"
  Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X
  FEBS Lett. 579:3849-3854(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 719883 0937119471