keyword in microRNA or target gene :
The pre-miRNA of MI0002464
Gene
HGNC MIRN412
Accession no
MI0002464
ID
hsa-mir-412
Species
Homo sapiens
Description
Homo sapiens miR-412 stem-loop
Genomic Location
14 : 100601537 - 100601627 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
91 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-412 hsa-mir-412 rno-mir-412
The mature miRNA of MI0002464
Mature name
hsa-miR-412
Mature sequence
54| 5'- ACUUCACCUGGUCCACUAGCCGU -3' |76
Target genes
ENST00000375753 (targeted by hsa-miR-412, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000167825 (targeted by hsa-miR-412, predicted by TargetScan)
Rho guanine nucleotide exchange factor (GEF) 10-like isoform 2 [Source:RefSeq_peptide;Acc:NP_001011722]
 
     
ENST00000375226 (targeted by hsa-miR-412, predicted by TargetScan)
retinoblastoma-associated factor 600 [Source:RefSeq_peptide;Acc:NP_065816]
 
     
   
 
The reference
Literature
1. "Clustering and conservation patterns of human microRNAs"
  Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H
  Nucleic Acids Res. 33:2697-2706(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 406324 0937119471