keyword in microRNA or target gene :
The pre-miRNA of MI0001651
Gene
Accession no
MI0001651
ID
cfa-mir-449
Species
Canis familiaris
Description
Canis familiaris miR-449 stem-loop
Genomic Location
2 : 45390354 - 45390444 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENSCAFT00000010868 intron + 2
ENSCAFT00000010869 intron + 2
ENSCAFT00000035684 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
91 nt
Comments
Xie et al. [1] refer to this sequence by the internal identifier MIR54. The sequence is unrelated to C. elegans mir-54 (MIR:MI0000025).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-449 mmu-mir-449 rno-mir-449 cfa-mir-449 gga-mir-449
xtr-mir-449 mdo-mir-449
The mature miRNA of MI0001651
Mature name
cfa-miR-449
Mature sequence
16| 5'- UGGCAGUGUAUUGUUAGCUGGU -3' |37
Target genes
ENSCAFT00000000229 (targeted by cfa-miR-449, predicted by TargetScan)
 
     
ENSCAFT00000000450 (targeted by cfa-miR-449, predicted by TargetScan)
 
     
ENSCAFT00000001003 (targeted by cfa-miR-449, predicted by TargetScan)
 
     
   
 
The reference
Literature
1. "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
  Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M
  Nature. 434:338-345(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 687065 0937119471