keyword in microRNA or target gene :
The pre-miRNA of MI0001648
Gene
HGNC MIRN449
Accession no
MI0001648
ID
hsa-mir-449
Species
Homo sapiens
Description
Homo sapiens miR-449 stem-loop
Genomic Location
5 : 54502117 - 54502207 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000381375 intron + 2
ENST00000296733 intron + 2
ENST00000322374 intron + 2
ENST00000334206 intron + 2
ENST00000331730 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
91 nt
Comments
Xie et al. [1] refer to this sequence by the internal identifier MIR54. The sequence is unrelated to C. elegans mir-54 (MIR:MI0000025).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-449 mmu-mir-449 rno-mir-449 cfa-mir-449 gga-mir-449
xtr-mir-449 mdo-mir-449
The mature miRNA of MI0001648
Mature name
hsa-miR-449
Mature sequence
16| 5'- UGGCAGUGUAUUGUUAGCUGGU -3' |37
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000378398 (targeted by hsa-miR-449, predicted by TargetScan)
PR domain zinc finger protein 16 (PR domain-containing protein 16) (Transcription factor MEL1). [Source:Uniprot/SWISSPROT;Acc:Q9HAZ2]
 
     
ENST00000377565 (targeted by hsa-miR-449, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-449, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
  Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M
  Nature. 434:338-345(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 652278 0937119471