keyword in microRNA or target gene :
The pre-miRNA of MI0001647
Gene
Accession no
MI0001647
ID
cfa-mir-365-2
Species
Canis familiaris
Description
Canis familiaris miR-365-2 stem-loop
Genomic Location
9 : 44628551 - 44628661 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
111 nt
Comments
Xie et al. [1] refer to this sequence by the internal identifier MIR190. The sequence is unrelated to mammalian mir-190 (MIR:MI0000486).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-365-1 mmu-mir-365-1 hsa-mir-365-2 mmu-mir-365-2 cfa-mir-365-2
rno-mir-365 cfa-mir-365-1 dre-mir-365-1 dre-mir-365-2 dre-mir-365-3
dre-mir-365-4 fru-mir-365 tni-mir-365 gga-mir-365-1 gga-mir-365-2
xtr-mir-365-1 mdo-mir-365 bta-mir-365
The mature miRNA of MI0001647
Mature name
cfa-miR-365
Mature sequence
68| 5'- UAAUGCCCCUAAAAAUCCUUAU -3' |89
Target genes
ENSCAFT00000000266 (targeted by cfa-miR-365, predicted by miRanda)
Mothers against decapentaplegic-like 4 (Fragment). [Source:Uniprot/SPTREMBL;Acc:Q6JDJ5]
 
     
ENSCAFT00000000314 (targeted by cfa-miR-365, predicted by miRanda)
 
     
ENSCAFT00000001573 (targeted by cfa-miR-365, predicted by miRanda)
Triadin. [Source:Uniprot/SWISSPROT;Acc:P82179]
 
     
   
 
The reference
Literature
1. "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
  Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M
  Nature. 434:338-345(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 901009 0937119471