keyword in microRNA or target gene :
The pre-miRNA of MI0001644
Gene
Accession no
MI0001644
ID
cfa-mir-429
Species
Canis familiaris
Description
Canis familiaris miR-429 stem-loop
Genomic Location
5 : 59371702 - 59371786 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
85 nt
Comments
Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MIR:MI0000244).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
dme-mir-8 mmu-mir-141 mmu-mir-200b hsa-mir-200b hsa-mir-141
mmu-mir-200a hsa-mir-200c mmu-mir-200c hsa-mir-200a rno-mir-141
rno-mir-200c rno-mir-200a rno-mir-200b gga-mir-200a gga-mir-200b
dps-mir-8 xla-mir-429 ame-mir-8 aga-mir-8 hsa-mir-429
mmu-mir-429 rno-mir-429 cfa-mir-429 dre-mir-429 dre-mir-141
dre-mir-200a dre-mir-200b dre-mir-200c mml-mir-200c mml-mir-141
ggo-mir-200c ggo-mir-141 ppy-mir-200c ppy-mir-141 ppa-mir-141
fru-mir-429 tni-mir-429 fru-mir-200a tni-mir-200a fru-mir-200b
tni-mir-200b gga-mir-429 xtr-mir-200a xtr-mir-200b xtr-mir-429
bmo-mir-8 bta-mir-200a bta-mir-200c bta-mir-200b mdo-mir-200c
mdo-mir-141 mdo-mir-200b mdo-mir-200a
The mature miRNA of MI0001644
Mature name
cfa-miR-429
Mature sequence
53| 5'- UAAUACUGUCUGGUAAUGCCGU -3' |74
Target genes
ENSCAFT00000034196 (targeted by cfa-miR-429, predicted by miRanda)
5S ribosomal RNA [Source: RFAM 7.0] [Source:RFAM;Acc:RF00001]
 
     
ENSCAFT00000000229 (targeted by cfa-miR-429, predicted by miRanda)
 
     
ENSCAFT00000000266 (targeted by cfa-miR-429, predicted by miRanda)
Mothers against decapentaplegic-like 4 (Fragment). [Source:Uniprot/SPTREMBL;Acc:Q6JDJ5]
 
     
   
 
The reference
Literature
1. "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
  Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M
  Nature. 434:338-345(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 134204 0937119471