keyword in microRNA or target gene :
The pre-miRNA of MI0001640
Gene
Accession no
MI0001640
ID
cfa-mir-448
Species
Canis familiaris
Description
Canis familiaris miR-448 stem-loop
Genomic Location
X : 90622997 - 90623106 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
110 nt
Comments
Xie et al. [1] refer to this sequence by the internal identifier MIR64. The sequence is unrelated to C. elegans mir-64 (MIR:MI0000035).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-448 mmu-mir-448 rno-mir-448 cfa-mir-448
The mature miRNA of MI0001640
Mature name
cfa-miR-448
Mature sequence
70| 5'- UUGCAUAUGUAGGAUGUCCCAU -3' |91
Target genes
ENSCAFT00000000067 (targeted by cfa-miR-448, predicted by miRanda)
 
     
ENSCAFT00000000266 (targeted by cfa-miR-448, predicted by miRanda)
Mothers against decapentaplegic-like 4 (Fragment). [Source:Uniprot/SPTREMBL;Acc:Q6JDJ5]
 
     
ENSCAFT00000000877 (targeted by cfa-miR-448, predicted by miRanda)
 
     
   
 
The reference
Literature
1. "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
  Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M
  Nature. 434:338-345(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 253912 0937119471