keyword in microRNA or target gene :
The pre-miRNA of MI0001618
Gene
Accession no
MI0001618
ID
aga-mir-281
Species
Anopheles gambiae
Description
Anopheles gambiae miR-281 stem-loop
Genomic Location
2L : 17362421 - 17362522 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
102 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
cel-mir-46 cel-mir-47 dme-mir-281-1 dme-mir-281-2 cbr-mir-46
cbr-mir-47 dps-mir-281-1 dps-mir-281-2 ame-mir-281 aga-mir-281
The mature miRNA of MI0001618
Mature name
aga-miR-281
Mature sequence
57| 5'- UGUCAUGGAAUUGCUCUCUUUAU -3' |79
Target genes
ENSANGT00000016043 (targeted by aga-miR-281, predicted by miRanda)
Histone H2B. [Source:Uniprot/SWISSPROT;Acc:Q27442]
 
     
ENSANGT00000015304 (targeted by aga-miR-281, predicted by miRanda)
 
     
ENSANGT00000012588 (targeted by aga-miR-281, predicted by miRanda)
Odorant-binding protein AgamOBP9. [Source:Uniprot/SPTREMBL;Acc:Q8I8R2]
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 667808 0937119471