keyword in microRNA or target gene :
The pre-miRNA of MI0001617
Gene
Accession no
MI0001617
ID
aga-mir-279
Species
Anopheles gambiae
Description
Anopheles gambiae miR-279 stem-loop
Genomic Location
2R : 55573327 - 55573415 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENSANGT00000030913 intron + 1
ENSANGT00000030912 intron + 1
ENSANGT00000030186 exon + 1
View the flanking features in the Genome Browser
Pre-miRNA length
89 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
dme-mir-279 dps-mir-279 aga-mir-279
The mature miRNA of MI0001617
Mature name
aga-miR-279
Mature sequence
56| 5'- UGACUAGAUCCACACUCAUUAA -3' |77
Target genes
ENSANGT00000013008 (targeted by aga-miR-279, predicted by miRanda)
 
     
ENSANGT00000019074 (targeted by aga-miR-279, predicted by miRanda)
 
     
ENSANGT00000011957 (targeted by aga-miR-279, predicted by miRanda)
Cecropin-A precursor [Contains: Cecropin-A; Cecropin-A amidated isoform]. [Source:Uniprot/SWISSPROT;Acc:P82290]
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 985487 0937119471