keyword in microRNA or target gene :
The pre-miRNA of MI0001616
Gene
Accession no
MI0001616
ID
aga-mir-278
Species
Anopheles gambiae
Description
Anopheles gambiae miR-278 stem-loop
Genomic Location
3L : 34112621 - 34112703 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
83 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
dme-mir-278 dps-mir-278 ame-mir-278 aga-mir-278
The mature miRNA of MI0001616
Mature name
aga-miR-278
Mature sequence
54| 5'- UCGGUGGGACUUUCGUCCGUUU -3' |75
Target genes
ENSANGT00000029660 (targeted by aga-miR-278, predicted by miRanda)
 
     
ENSANGT00000020589 (targeted by aga-miR-278, predicted by miRanda)
 
     
ENSANGT00000015293 (targeted by aga-miR-278, predicted by miRanda)
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 71062 0937119471