keyword in microRNA or target gene :
The pre-miRNA of MI0001615
Gene
Accession no
MI0001615
ID
aga-mir-277
Species
Anopheles gambiae
Description
Anopheles gambiae miR-277 stem-loop
Genomic Location
2R : 28234523 - 28234612 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
90 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
dme-mir-277 dps-mir-277 ame-mir-277 aga-mir-277 bmo-mir-277
The mature miRNA of MI0001615
Mature name
aga-miR-277
Mature sequence
59| 5'- UAAAUGCACUAUCUGGUACGACA -3' |81
Target genes
ENSANGT00000029051 (targeted by aga-miR-277, predicted by miRanda)
 
     
ENSANGT00000012374 (targeted by aga-miR-277, predicted by miRanda)
 
     
ENSANGT00000012588 (targeted by aga-miR-277, predicted by miRanda)
Odorant-binding protein AgamOBP9. [Source:Uniprot/SPTREMBL;Acc:Q8I8R2]
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 68245 0937119471