keyword in microRNA or target gene :
The pre-miRNA of MI0001614
Gene
Accession no
MI0001614
ID
aga-mir-276
Species
Anopheles gambiae
Description
Anopheles gambiae miR-276 stem-loop
Genomic Location
2L : 18991754 - 18991845 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
92 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
dme-mir-276a dme-mir-276b dps-mir-276a dps-mir-276b ame-mir-276
aga-mir-276 bmo-mir-276
The mature miRNA of MI0001614
Mature name
aga-miR-276
Mature sequence
13| 5'- CAGCGAGGUAUAGAGUUCCUACG -3' |35
Target genes
ENSANGT00000022451 (targeted by aga-miR-276, predicted by miRanda)
 
     
ENSANGT00000000004 (targeted by aga-miR-276, predicted by miRanda)
Histone H2a (Fragment). [Source:Uniprot/SPTREMBL;Acc:P90675]
 
     
ENSANGT00000020589 (targeted by aga-miR-276, predicted by miRanda)
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 564249 0937119471