keyword in microRNA or target gene :
The pre-miRNA of MI0001613
Gene
Accession no
MI0001613
ID
aga-mir-275
Species
Anopheles gambiae
Description
Anopheles gambiae miR-275 stem-loop
Genomic Location
3R : 38377342 - 38377436 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
95 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
dme-mir-275 dps-mir-275 aga-mir-275
The mature miRNA of MI0001613
Mature name
aga-miR-275
Mature sequence
61| 5'- UCAGGUACCUGAAGUAGCGCGCG -3' |83
Target genes
ENSANGT00000022451 (targeted by aga-miR-275, predicted by miRanda)
 
     
ENSANGT00000024222 (targeted by aga-miR-275, predicted by miRanda)
 
     
ENSANGT00000014414 (targeted by aga-miR-275, predicted by miRanda)
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 628043 0937119471