keyword in microRNA or target gene :
The pre-miRNA of MI0001612
Gene
Accession no
MI0001612
ID
aga-mir-263
Species
Anopheles gambiae
Description
Anopheles gambiae miR-263 stem-loop
Genomic Location
3R : 12395476 - 12395561 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
86 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
dme-mir-263a dme-mir-263b dps-mir-263a dps-mir-263b ame-mir-263
aga-mir-263 bmo-mir-263b bmo-mir-263a
The mature miRNA of MI0001612
Mature name
aga-miR-263
Mature sequence
11| 5'- UGUAAUGGCACUGGAAGAAUUCAC -3' |34
Target genes
ENSANGT00000014414 (targeted by aga-miR-263, predicted by miRanda)
 
     
ENSANGT00000019886 (targeted by aga-miR-263, predicted by miRanda)
 
     
ENSANGT00000019901 (targeted by aga-miR-263, predicted by miRanda)
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 641404 0937119471