keyword in microRNA or target gene :
The pre-miRNA of MI0001611
Gene
Accession no
MI0001611
ID
aga-mir-219
Species
Anopheles gambiae
Description
Anopheles gambiae miR-219 stem-loop
Genomic Location
2L : 21839672 - 21839758 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
87 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-219-1 dme-mir-219 mmu-mir-219-1 hsa-mir-219-2 mmu-mir-219-2
rno-mir-219-1 rno-mir-219-2 gga-mir-219 dps-mir-219 dre-mir-219-1
dre-mir-219-2 ame-mir-219 aga-mir-219 dre-mir-219-3 mml-mir-219
ggo-mir-219 ppy-mir-219 fru-mir-219-2 tni-mir-219-2 fru-mir-219-1
tni-mir-219-1 xtr-mir-219 mdo-mir-219
The mature miRNA of MI0001611
Mature name
aga-miR-219
Mature sequence
11| 5'- UGAUUGUCCAAACGCAAUUCUUG -3' |33
Target genes
ENSANGT00000016179 (targeted by aga-miR-219, predicted by miRanda)
 
     
ENSANGT00000017299 (targeted by aga-miR-219, predicted by miRanda)
clip-domain serine protease subfamily c [Source:Anopheles_symbol;Acc:CLIPC5]
 
     
ENSANGT00000019220 (targeted by aga-miR-219, predicted by miRanda)
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 467942 0937119471