keyword in microRNA or target gene :
The pre-miRNA of MI0001610
Gene
Accession no
MI0001610
ID
aga-mir-210
Species
Anopheles gambiae
Description
Anopheles gambiae miR-210 stem-loop
Genomic Location
X : 21450335 - 21450414 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
80 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-210 dme-mir-210 mmu-mir-210 rno-mir-210 dps-mir-210
dre-mir-210 ame-mir-210 aga-mir-210 fru-mir-210 tni-mir-210
xtr-mir-210 bta-mir-210
The mature miRNA of MI0001610
Mature name
aga-miR-210
Mature sequence
49| 5'- UUGUGCGUGUGACAACGGCUA -3' |69
Target genes
ENSANGT00000002531 (targeted by aga-miR-210, predicted by miRanda)
 
     
ENSANGT00000020589 (targeted by aga-miR-210, predicted by miRanda)
 
     
ENSANGT00000013670 (targeted by aga-miR-210, predicted by miRanda)
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 537286 0937119471