keyword in microRNA or target gene :
The pre-miRNA of MI0001609
Gene
Accession no
MI0001609
ID
aga-mir-184
Species
Anopheles gambiae
Description
Anopheles gambiae miR-184 stem-loop
Genomic Location
3R : 42632357 - 42632438 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
82 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-184 dme-mir-184 hsa-mir-184 rno-mir-184 gga-mir-184
dps-mir-184 ame-mir-184 aga-mir-184 dre-mir-184 ssc-mir-184
ptr-mir-184 ppy-mir-184 mne-mir-184 fru-mir-184 tni-mir-184
dre-mir-184-2 xtr-mir-184 mdo-mir-184
The mature miRNA of MI0001609
Mature name
aga-miR-184
Mature sequence
51| 5'- UGGACGGAGAACUGAUAAGGG -3' |71
Target genes
ENSANGT00000018946 (targeted by aga-miR-184, predicted by miRanda)
 
     
ENSANGT00000016179 (targeted by aga-miR-184, predicted by miRanda)
 
     
ENSANGT00000026978 (targeted by aga-miR-184, predicted by miRanda)
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 4977 0937119471