keyword in microRNA or target gene :
The pre-miRNA of MI0001608
Gene
Accession no
MI0001608
ID
aga-mir-14
Species
Anopheles gambiae
Description
Anopheles gambiae miR-14 stem-loop
Genomic Location
3R : 24898041 - 24898134 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
94 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
dme-mir-14 dps-mir-14 aga-mir-14
The mature miRNA of MI0001608
Mature name
aga-miR-14
Mature sequence
58| 5'- UCAGUCUUUUUCUCUCUCCUA -3' |78
Target genes
ENSANGT00000022451 (targeted by aga-miR-14, predicted by miRanda)
 
     
ENSANGT00000019138 (targeted by aga-miR-14, predicted by miRanda)
 
     
ENSANGT00000008112 (targeted by aga-miR-14, predicted by miRanda)
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 101925 0937119471