keyword in microRNA or target gene :
The pre-miRNA of MI0001607
Gene
Accession no
MI0001607
ID
aga-mir-13b
Species
Anopheles gambiae
Description
Anopheles gambiae miR-13b stem-loop
Genomic Location
2L : 37757564 - 37757657 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
94 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
cel-mir-2 dme-mir-2a-1 dme-mir-2a-2 dme-mir-2b-1 dme-mir-2b-2
dme-mir-13a dme-mir-13b-1 dme-mir-13b-2 dme-mir-2c dps-mir-2a-1
dps-mir-2a-2 dps-mir-2b-1 dps-mir-2b-2 dps-mir-2c dps-mir-13a
dps-mir-13b-1 dps-mir-13b-2 ame-mir-2-1 ame-mir-2-2 aga-mir-13b
sme-mir-2a-1 sme-mir-2a-2 sme-mir-2b sme-mir-2c sme-mir-2d
ame-mir-13a ame-mir-2-3
The mature miRNA of MI0001607
Mature name
aga-miR-13b
Mature sequence
56| 5'- UAUCACAGCCAUUUUGACGAGU -3' |77
Target genes
ENSANGT00000026978 (targeted by aga-miR-13b, predicted by miRanda)
 
     
ENSANGT00000016399 (targeted by aga-miR-13b, predicted by miRanda)
 
     
ENSANGT00000016043 (targeted by aga-miR-13b, predicted by miRanda)
Histone H2B. [Source:Uniprot/SWISSPROT;Acc:Q27442]
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 409741 0937119471