keyword in microRNA or target gene :
The pre-miRNA of MI0001606
Gene
Accession no
MI0001606
ID
aga-mir-133
Species
Anopheles gambiae
Description
Anopheles gambiae miR-133 stem-loop
Genomic Location
3R : 15075187 - 15075263 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
77 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-133a-1 dme-mir-133 hsa-mir-133a-1 hsa-mir-133a-2 mmu-mir-133a-2
mmu-mir-133b hsa-mir-133b rno-mir-133a gga-mir-133a-1 gga-mir-133b
gga-mir-133a-2 gga-mir-133c dps-mir-133 xla-mir-133a ame-mir-133
aga-mir-133 dre-mir-133a-2 dre-mir-133a-1 dre-mir-133b dre-mir-133c
ggo-mir-133a age-mir-133a ppa-mir-133a ppy-mir-133a ptr-mir-133a
mml-mir-133a sla-mir-133a lla-mir-133a mne-mir-133a fru-mir-133
tni-mir-133 rno-mir-133b xtr-mir-133c xtr-mir-133d xtr-mir-133b
xtr-mir-133a mdo-mir-133a
The mature miRNA of MI0001606
Mature name
aga-miR-133
Mature sequence
34| 5'- UUGGUCCCCUUCAACCAGCUGU -3' |55
Target genes
ENSANGT00000016179 (targeted by aga-miR-133, predicted by miRanda)
 
     
ENSANGT00000010517 (targeted by aga-miR-133, predicted by miRanda)
 
     
ENSANGT00000024749 (targeted by aga-miR-133, predicted by miRanda)
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 912455 0937119471