keyword in microRNA or target gene :
The pre-miRNA of MI0001605
Gene
Accession no
MI0001605
ID
aga-mir-125
Species
Anopheles gambiae
Description
Anopheles gambiae miR-125 stem-loop
Genomic Location
3R : 10270160 - 10270271 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
112 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-125a mmu-mir-125b-2 dme-mir-125 hsa-mir-125b-1 hsa-mir-125a
hsa-mir-125b-2 mmu-mir-125b-1 rno-mir-125a rno-mir-125b-1 rno-mir-125b-2
gga-mir-125b dps-mir-125 ame-mir-125 aga-mir-125 dre-mir-125a-1
dre-mir-125a-2 dre-mir-125b-1 dre-mir-125b-2 dre-mir-125b-3 dre-mir-125c
ssc-mir-125b ggo-mir-125b-1 age-mir-125b-1 ppa-mir-125b ppy-mir-125b-1
ptr-mir-125b-1 mml-mir-125b-1 sla-mir-125b lla-mir-125b-1 mne-mir-125b-1
ggo-mir-125b-2 age-mir-125b-2 lca-mir-125b ppy-mir-125b-2 ptr-mir-125b-2
mml-mir-125b-2 lla-mir-125b-2 mne-mir-125b-2 fru-mir-125b tni-mir-125b
fru-mir-125a tni-mir-125a bta-mir-125a bta-mir-125b-1 xtr-mir-125b-1
xtr-mir-125b-2 xtr-mir-125a mdo-mir-125b-1 mdo-mir-125b-2 bta-mir-125b-2
The mature miRNA of MI0001605
Mature name
aga-miR-125
Mature sequence
30| 5'- UCCCUGAGACCCUAACUUGUGA -3' |51
Target genes
ENSANGT00000024222 (targeted by aga-miR-125, predicted by miRanda)
 
     
ENSANGT00000014416 (targeted by aga-miR-125, predicted by miRanda)
 
     
ENSANGT00000017373 (targeted by aga-miR-125, predicted by miRanda)
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 295526 0937119471