keyword in microRNA or target gene :
The pre-miRNA of MI0001604
Gene
Accession no
MI0001604
ID
aga-mir-124
Species
Anopheles gambiae
Description
Anopheles gambiae miR-124 stem-loop
Genomic Location
3R : 29001980 - 29002062 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
83 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-124a-3 cel-mir-124 dme-mir-124 hsa-mir-124a-1 hsa-mir-124a-2
hsa-mir-124a-3 cbr-mir-124 mmu-mir-124a-1 mmu-mir-124a-2 rno-mir-124a-3
rno-mir-124a-1 rno-mir-124a-2 gga-mir-124a gga-mir-124b-1 gga-mir-124b-2
dps-mir-124 ame-mir-124 aga-mir-124 dre-mir-124-1 dre-mir-124-2
dre-mir-124-3 dre-mir-124-4 dre-mir-124-5 dre-mir-124-6 ssc-mir-124a
ggo-mir-124a age-mir-124a ppa-mir-124a ppy-mir-124a ptr-mir-124a
mml-mir-124a lla-mir-124a fru-mir-124-3 tni-mir-124-3 fru-mir-124-1
tni-mir-124-1 fru-mir-124-2 tni-mir-124-2 xtr-mir-124 bmo-mir-124
bta-mir-124a mdo-mir-124a-1 mdo-mir-124a-2 mdo-mir-124a-3
The mature miRNA of MI0001604
Mature name
aga-miR-124
Mature sequence
53| 5'- UAAGGCACGCGGUGAAUGCCAAG -3' |75
Target genes
ENSANGT00000012923 (targeted by aga-miR-124, predicted by miRanda)
 
     
ENSANGT00000026569 (targeted by aga-miR-124, predicted by miRanda)
 
     
ENSANGT00000014446 (targeted by aga-miR-124, predicted by miRanda)
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 465737 0937119471