keyword in microRNA or target gene :
The pre-miRNA of MI0001603
Gene
Accession no
MI0001603
ID
aga-mir-100
Species
Anopheles gambiae
Description
Anopheles gambiae miR-100 stem-loop
Genomic Location
3R : 10274677 - 10274768 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
92 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-99a hsa-mir-100 mmu-mir-99a mmu-mir-99b dme-mir-100
mmu-mir-100 hsa-mir-99b rno-mir-99a rno-mir-99b rno-mir-100
gga-mir-99a gga-mir-100 dps-mir-100 aga-mir-100 dre-mir-99-1
dre-mir-99-2 dre-mir-100-1 dre-mir-100-2 mml-mir-99a ptr-mir-99a
ggo-mir-99a ppy-mir-99a lla-mir-99a mne-mir-99a ppa-mir-99a
ggo-mir-100 age-mir-100 ppa-mir-100 ppy-mir-100 ptr-mir-100
mml-mir-100 sla-mir-100 lla-mir-100 fru-mir-100 tni-mir-100
bta-mir-99a xtr-mir-99 xtr-mir-100 mdo-mir-100 bta-mir-99b
ame-mir-100
The mature miRNA of MI0001603
Mature name
aga-miR-100
Mature sequence
15| 5'- AACCCGUAGAUCCGAACUUGUG -3' |36
Target genes
ENSANGT00000029660 (targeted by aga-miR-100, predicted by miRanda)
 
     
ENSANGT00000001712 (targeted by aga-miR-100, predicted by miRanda)
 
     
ENSANGT00000001748 (targeted by aga-miR-100, predicted by miRanda)
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 683062 0937119471