keyword in microRNA or target gene :
The pre-miRNA of MI0001602
Gene
Accession no
MI0001602
ID
aga-mir-10
Species
Anopheles gambiae
Description
Anopheles gambiae miR-10 stem-loop
Genomic Location
2R : 59711765 - 59711866 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
102 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
dme-mir-10 mmu-mir-10b hsa-mir-10a hsa-mir-10b mmu-mir-10a
rno-mir-10a rno-mir-10b gga-mir-10b dps-mir-10 dre-mir-10a
dre-mir-10b-1 aga-mir-10 dre-mir-10b-2 dre-mir-10c dre-mir-10d-1
dre-mir-10d-2 ggo-mir-10a ppy-mir-10a sla-mir-10a age-mir-10a
ppa-mir-10a ggo-mir-10b mne-mir-10b ppa-mir-10b fru-mir-10b-1
tni-mir-10b-2 fru-mir-10b-2 tni-mir-10b-1 fru-mir-10c tni-mir-10c
xtr-mir-10a xtr-mir-10b xtr-mir-10c tni-mir-10d fru-mir-10d
bmo-mir-10 bta-mir-10a bta-mir-10b mdo-mir-10a mdo-mir-10b
ame-mir-10
The mature miRNA of MI0001602
Mature name
aga-miR-10
Mature sequence
22| 5'- ACCCUGUAGAUCCGAAUUUGU -3' |42
Target genes
ENSANGT00000020589 (targeted by aga-miR-10, predicted by miRanda)
 
     
ENSANGT00000001712 (targeted by aga-miR-10, predicted by miRanda)
 
     
ENSANGT00000014567 (targeted by aga-miR-10, predicted by miRanda)
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 555383 0937119471