keyword in microRNA or target gene :
The pre-miRNA of MI0001601
Gene
Accession no
MI0001601
ID
aga-mir-1
Species
Anopheles gambiae
Description
Anopheles gambiae miR-1 stem-loop
Genomic Location
3R : 10569154 - 10569251 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
98 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
cel-mir-1 dme-mir-1 mmu-mir-1-1 mmu-mir-206 hsa-mir-1-2
hsa-mir-206 cbr-mir-1 hsa-mir-1-1 mmu-mir-1-2 rno-mir-206
gga-mir-1a-2 gga-mir-206 gga-mir-1a-1 gga-mir-1b dps-mir-1
ame-mir-1 aga-mir-1 dre-mir-1-2 dre-mir-1-1 dre-mir-206-1
dre-mir-206-2 ppy-mir-206 mne-mir-206 ppa-mir-1 fru-mir-1
tni-mir-1 rno-mir-1 xtr-mir-1a-2 xtr-mir-1a-1 xtr-mir-206
xtr-mir-1b bmo-mir-1 mdo-mir-1 mdo-mir-206
The mature miRNA of MI0001601
Mature name
aga-miR-1
Mature sequence
62| 5'- UGGAAUGUAAAGAAGUAUGGAG -3' |83
Target genes
ENSANGT00000023743 (targeted by aga-miR-1, predicted by miRanda)
 
     
ENSANGT00000018946 (targeted by aga-miR-1, predicted by miRanda)
 
     
ENSANGT00000020753 (targeted by aga-miR-1, predicted by miRanda)
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 946035 0937119471