keyword in microRNA or target gene :
The pre-miRNA of MI0001599
Gene
Accession no
MI0001599
ID
aga-bantam
Species
Anopheles gambiae
Description
Anopheles gambiae bantam stem-loop
Genomic Location
2R : 33274498 - 33274608 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
111 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
dme-bantam dps-bantam ame-bantam aga-bantam
The mature miRNA of MI0001599
Mature name
aga-bantam
Mature sequence
70| 5'- UGAGAUCACUUUGAAAGCUGAUU -3' |92
Target genes
ENSANGT00000010517 (targeted by aga-bantam, predicted by miRanda)
 
     
ENSANGT00000012588 (targeted by aga-bantam, predicted by miRanda)
Odorant-binding protein AgamOBP9. [Source:Uniprot/SPTREMBL;Acc:Q8I8R2]
 
     
ENSANGT00000013008 (targeted by aga-bantam, predicted by miRanda)
 
     
   
 
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 73453 0937119471