keyword in microRNA or target gene :
The pre-miRNA of MI0001445
Gene
HGNC MIRN423
EMBL AY882274
Accession no
MI0001445
ID
hsa-mir-423
Species
Homo sapiens
Description
Homo sapiens miR-423 stem-loop
Genomic Location
17 : 25468223 - 25468316 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000247026 intron + 1
OTTHUMT00000281185 intron + 1
OTTHUMT00000281192 intron + 1
OTTHUMT00000281186 intron + 1
OTTHUMT00000281187 intron + 1
OTTHUMT00000281184 intron + 11
OTTHUMT00000281193 exon + 1
OTTHUMT00000281190 intron + 1
OTTHUMT00000281191 intron + 1
OTTHUMT00000281189 intron + 1
OTTHUMT00000281183 exon + 1
OTTHUMT00000256122 intron + 1
OTTHUMT00000256124 exon + 1
OTTHUMT00000256123 intron + 1
OTTHUMT00000256121 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
94 nt
Comments
miR-423 is expressed in human promyelocytic leukemia (HL-60) cells [1]. The level of expression was shown to be up-regulated 48 hours after TPA-induction.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-423 mmu-mir-423 bta-mir-423
The mature miRNA of MI0001445
Mature name
hsa-miR-423
Mature sequence
53| 5'- AGCUCGGUCUGAGGCCCCUCAG -3' |74
Target genes
ENST00000357071 (targeted by hsa-miR-423, predicted by TargetScan)
Endothelin-converting enzyme 1 (EC 3.4.24.71) (ECE-1). [Source:Uniprot/SWISSPROT;Acc:P42892]
 
     
ENST00000374894 (targeted by hsa-miR-423, predicted by TargetScan)
Endothelin-converting enzyme 1 (EC 3.4.24.71) (ECE-1). [Source:Uniprot/SWISSPROT;Acc:P42892]
 
     
ENST00000264205 (targeted by hsa-miR-423, predicted by TargetScan)
Endothelin-converting enzyme 1 (EC 3.4.24.71) (ECE-1). [Source:Uniprot/SWISSPROT;Acc:P42892]
 
     
   
 
The reference
Literature
1. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 966876 0937119471