keyword in microRNA or target gene :
The pre-miRNA of MI0001444
Gene
HGNC MIRN422A
Accession no
MI0001444
ID
hsa-mir-422a
Species
Homo sapiens
Description
Homo sapiens miR-422a stem-loop
Genomic Location
15 : 61950182 - 61950271 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
90 nt
Comments
miR-422a is an predicted paralogue of miR-422b (MIR:MI0001443) -- its expression has not been validated [1].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
The mature miRNA of MI0001444
Mature name
hsa-miR-422a
Mature sequence
11| 5'- CUGGACUUAGGGUCAGAAGGCC -3' |32
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000337907 (targeted by hsa-miR-422a, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-422a, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000373388 (targeted by hsa-miR-422a, predicted by TargetScan)
CUB and sushi domain-containing protein 2 (CUB and sushi multiple domains protein 2). [Source:Uniprot/SWISSPROT;Acc:Q7Z408]
 
     
   
 
The reference
Literature
1. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 726931 0937119471