keyword in microRNA or target gene :
The pre-miRNA of MI0001150
Gene
HGNC MIRN196B
Accession no
MI0001150
ID
hsa-mir-196b
Species
Homo sapiens
Description
Homo sapiens miR-196b stem-loop
Genomic Location
7 : 27175624 - 27175707 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000354032 3UTR + 3
OTTHUMT00000268485 intron + 1
OTTHUMT00000139972 exon + 1
OTTHUMT00000139973 intron + 1
OTTHUMT00000139982 exon - 1
OTTHUMT00000139981 exon - 2
View the flanking features in the Genome Browser
Pre-miRNA length
84 nt
Comments
miR-196b is predicted based on sequence homology to miR-196a [1]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [1].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-196a-1 hsa-mir-196a-2 mmu-mir-196a-1 mmu-mir-196a-2 rno-mir-196a
hsa-mir-196b mmu-mir-196b rno-mir-196b gga-mir-196-2 gga-mir-196-1
gga-mir-196-3 dre-mir-196a-1 dre-mir-196a-2 dre-mir-196b ssc-mir-196
mml-mir-196 ggo-mir-196-1 ppy-mir-196-1 ptr-mir-196 ggo-mir-196-2
ppy-mir-196-2 lla-mir-196 age-mir-196 ppa-mir-196 fru-mir-196a-2
tni-mir-196a-2 fru-mir-196a-1 tni-mir-196a-1 fru-mir-196b tni-mir-196b
xtr-mir-196a xtr-mir-196b mdo-mir-196b
The mature miRNA of MI0001150
Mature name
hsa-miR-196b
Mature sequence
15| 5'- UAGGUAGUUUCCUGUUGUUGG -3' |35
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000377998 (targeted by hsa-miR-196b, predicted by TargetScan)
Chromodomain helicase-DNA-binding protein 5 (EC 3.6.1.-) (ATP- dependent helicase CHD5) (CHD-5). [Source:Uniprot/SWISSPROT;Acc:Q8TDI0]
 
     
ENST00000246151 (targeted by hsa-miR-196b, predicted by TargetScan)
thioredoxin family Trp26 [Source:RefSeq_peptide;Acc:NP_065095]
 
     
ENST00000373633 (targeted by hsa-miR-196b, predicted by TargetScan)
Transmembrane protein 39B. [Source:Uniprot/SWISSPROT;Acc:Q9GZU3]
 
     
   
 
The reference
Literature
1. "MicroRNA-directed cleavage of HOXB8 mRNA"
  Yekta S, Shih IH, Bartel DP
  Science. 304:594-596(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 278159 0937119471