keyword in microRNA or target gene :
The pre-miRNA of MI0001145
Gene
HGNC MIRN384
Accession no
MI0001145
ID
hsa-mir-384
Species
Homo sapiens
Description
Homo sapiens miR-384 stem-loop
Genomic Location
X : 76056092 - 76056179 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
88 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-384 mmu-mir-384
The mature miRNA of MI0001145
Mature name
hsa-miR-384
Mature sequence
57| 5'- AUUCCUAGAAAUUGUUCAUA -3' |76
Target genes
ENST00000376572 (targeted by hsa-miR-384, predicted by TargetScan)
KIAA2013 (KIAA2013), mRNA [Source:RefSeq_dna;Acc:NM_138346]
 
     
ENST00000373909 (targeted by hsa-miR-384, predicted by TargetScan)
Replication protein A 32 kDa subunit (RP-A) (RF-A) (Replication factor-A protein 2) (p32) (p34). [Source:Uniprot/SWISSPROT;Acc:P15927]
 
     
ENST00000372811 (targeted by hsa-miR-384, predicted by TargetScan)
Major facilitator superfamily domain-containing protein 2. [Source:Uniprot/SWISSPROT;Acc:Q8NA29]
 
     
   
 
The reference
Literature
1. "A pancreatic islet-specific microRNA regulates insulin secretion"
  Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M
  Nature. 432:226-230(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 790387 0937119471