keyword in microRNA or target gene :
The pre-miRNA of MI0000826
Gene
HGNC MIRN346
Accession no
MI0000826
ID
hsa-mir-346
Species
Homo sapiens
Description
Homo sapiens miR-346 stem-loop
Genomic Location
10 : 88014431 - 88014525 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000372087 intron + 2
ENST00000327946 intron + 2
ENST00000372085 intron + 2
OTTHUMT00000049147 intron + 2
View the flanking features in the Genome Browser
Pre-miRNA length
95 nt
Comments
This sequence is the predicted human homologue [2] of a sequence cloned from rat neuronal tissue [1]. The mature miRNA differs from the rat sequence at two positions, and its expression has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
rno-mir-346 mmu-mir-346 hsa-mir-346
The mature miRNA of MI0000826
Mature name
hsa-miR-346
Mature sequence
20| 5'- UGUCUGCCCGCAUGCCUGCCUCU -3' |42
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000375753 (targeted by hsa-miR-346, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000375634 (targeted by hsa-miR-346, predicted by TargetScan)
Ephrin type-A receptor 2 precursor (EC 2.7.10.1) (Tyrosine-protein kinase receptor ECK) (Epithelial cell kinase). [Source:Uniprot/SWISSPROT;Acc:P29317]
 
     
ENST00000358432 (targeted by hsa-miR-346, predicted by TargetScan)
Ephrin type-A receptor 2 precursor (EC 2.7.10.1) (Tyrosine-protein kinase receptor ECK) (Epithelial cell kinase). [Source:Uniprot/SWISSPROT;Acc:P29317]
 
     
   
 
The reference
Literature
1. "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
  Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G
  Proc Natl Acad Sci U S A. 101:360-365(2004).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 970224 0937119471