keyword in microRNA or target gene :
The pre-miRNA of MI0000825
Gene
HGNC MIRN345
Accession no
MI0000825
ID
hsa-mir-345
Species
Homo sapiens
Description
Homo sapiens miR-345 stem-loop
Genomic Location
14 : 99843949 - 99844046 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
98 nt
Comments
This sequence is the predicted human homologue [2] of a sequence cloned from rat neuronal tissue [1]. The mature miRNA differs from the rat sequence at two positions, and its expression has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
rno-mir-345 mmu-mir-345 hsa-mir-345 bta-mir-345
The mature miRNA of MI0000825
Mature name
hsa-miR-345
Mature sequence
17| 5'- UGCUGACUCCUAGUCCAGGGC -3' |37
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000378513 (targeted by hsa-miR-345, predicted by TargetScan)
Protein RER1. [Source:Uniprot/SWISSPROT;Acc:O15258]
 
     
ENST00000378514 (targeted by hsa-miR-345, predicted by TargetScan)
Protein RER1. [Source:Uniprot/SWISSPROT;Acc:O15258]
 
     
ENST00000306256 (targeted by hsa-miR-345, predicted by TargetScan)
Protein RER1. [Source:Uniprot/SWISSPROT;Acc:O15258]
 
     
   
 
The reference
Literature
1. "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
  Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G
  Proc Natl Acad Sci U S A. 101:360-365(2004).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
3. "Identification of human fetal liver miRNAs by a novel method"
  Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X
  FEBS Lett. 579:3849-3854(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 666949 0937119471